first commit

index.js

@@ -0,0 +1,140 @@
+"use strict";
+var __awaiter = (this && this.__awaiter) || function (thisArg, _arguments, P, generator) {
+    function adopt(value) { return value instanceof P ? value : new P(function (resolve) { resolve(value); }); }
+    return new (P || (P = Promise))(function (resolve, reject) {
+        function fulfilled(value) { try { step(generator.next(value)); } catch (e) { reject(e); } }
+        function rejected(value) { try { step(generator["throw"](value)); } catch (e) { reject(e); } }
+        function step(result) { result.done ? resolve(result.value) : adopt(result.value).then(fulfilled, rejected); }
+        step((generator = generator.apply(thisArg, _arguments || [])).next());
+    });
+};
+Object.defineProperty(exports, "__esModule", { value: true });
+const child_process_1 = require("child_process");
+const async_exec = (prog, args, onData, onErr) => {
+    return new Promise((resolve, reject) => {
+        const child = (0, child_process_1.spawn)(prog, args, { shell: true });
+        child.stdout.on('data', data => onData(data.toString().trim()));
+        child.stderr.on('data', data => onErr(data.toString().trim()));
+        child.on('error', err => reject(err));
+        child.on('exit', code => resolve(code));
+    });
+};
+const diversitySeq = (Seq) => {
+    return Seq.split('').reduce((prev, _curr, id, array) => {
+        if (id != 0 && array[id] !== array[id - 1]) {
+            return prev + (1 / array.length);
+        }
+        else {
+            return prev;
+        }
+    }, 0);
+};
+const annotateSeq = (seq, blastDB, maxBlast = 100, minDiversity = 0.1, blastnPath = 'blastn') => __awaiter(void 0, void 0, void 0, function* () {
+    return new Promise((resolve, reject) => __awaiter(void 0, void 0, void 0, function* () {
+        try {
+            let results = '';
+            let sequence = { sequence: seq };
+            if (sequence.sequence) {
+                if (diversitySeq(sequence.sequence) > minDiversity) {
+                    const sequenceStr = '\'>GG\\n' + sequence.sequence + '\'';
+                    yield async_exec('echo', [sequenceStr, '|',
+                        blastnPath, '-db', blastDB, '-query', '-', '-outfmt', '6', '-max_target_seqs', '100'], (m) => results += m, console.log);
+                    if (results !== '') {
+                        //https://www.metagenomics.wiki/tools/blast/blastn-output-format-6
+                        const keys = [/*'qseqid',*/ 'sseqid', 'pident', 'length', 'mismatch', 'gapopen', 'qstart', 'qend', 'sstart', 'send', 'evalue', 'bitscore'];
+                        results.split('\n')
+                            .map((it, index) => sequence.blastn = [
+                            ...(sequence.blastn || []),
+                            Object.assign({ index }, it.split('\t')
+                                .slice(1)
+                                .reduce((a, v, i) => (Object.assign(Object.assign({}, a), { [keys[i]]: isNaN(parseInt(v)) ? v : parseInt(v) })), {}))
+                        ].splice(0, maxBlast));
+                        if (sequence.blastn.length === 0) {
+                            throw 'Blastn results parsing failed';
+                        }
+                    }
+                    else {
+                        // console.log('WARNING NO BLASTN RESULT', ['echo', '-e', ,'\'' + sequenceStr + '\'', '|',
+                        // blastn, '-db', blastDB, '-query', '-', '-outfmt', '6', '-max_target_seqs', '100'].join(' '))
+                        throw 'No blastn hit';
+                    }
+                }
+                else {
+                    throw 'Sequence diversity < ' + minDiversity;
+                }
+            }
+            else {
+                throw 'No sequence';
+            }
+            resolve(sequence);
+        }
+        catch (error) {
+            reject(error);
+        }
+    }));
+});
+const transpose = (matrix) => matrix.reduce(($, row) => row.map((_, i) => [...($[i] || []), row[i]]), []);
+const whichMax = (arr) => arr.flatMap((v, i) => v === Math.max(...arr) ? i : []);
+const getBlastRepr = (args) => __awaiter(void 0, void 0, void 0, function* () {
+    const { sequence, dbs } = args;
+    try {
+        let all_blastn = [];
+        for (const cdb of dbs) {
+            let res = [];
+            try {
+                res = yield annotateSeq(sequence, cdb);
+                if (res.blastn.length > 0)
+                    all_blastn = [...all_blastn, ...res.blastn].map((v, i) => { return Object.assign(Object.assign({}, v), { index: i + 1 }); });
+            }
+            catch (e) { }
+        }
+        const indiv_match = all_blastn.map((blastn) => {
+            const { start, end } = blastn.qstart <= blastn.qend ? { start: blastn.qstart, end: blastn.qend } : { end: blastn.qstart, start: blastn.qend };
+            return sequence.split('').map((_, i) => ((i + 1) >= start && (i + 1) <= end) ? '|' : '_').join('');
+        });
+        const bestRepr = transpose(indiv_match.map((v) => v.split(''))).map((v) => {
+            const tmp = v.map((c, i) => {
+                if (c === '|') {
+                    return all_blastn[i].length;
+                }
+                else {
+                    return 0;
+                }
+            });
+            if (Math.max(...tmp) === 0) {
+                return 0;
+            }
+            else {
+                return whichMax(tmp)[0] + 1;
+            }
+        });
+        let bestReprRed = [];
+        let n = 0;
+        let start = 0;
+        bestRepr.reduce((p, c, i) => {
+            if (p !== c) {
+                const name = p === 0 ? 'unknown' : all_blastn.filter((v) => v.index === p)[0].sseqid + ":" + all_blastn.filter((v) => v.index === p)[0].sstart + '-' + all_blastn.filter((v) => v.index === p)[0].send;
+                bestReprRed.push({ name, n, start, end: i });
+                start = (i + 1);
+                n = 0;
+            }
+            n++;
+            if (i === (bestRepr.length - 1)) {
+                const name = c === 0 ? 'unknown' : all_blastn.filter((v) => v.index === c)[0].sseqid + ":" + all_blastn.filter((v) => v.index === c)[0].sstart + '-' + all_blastn.filter((v) => v.index === c)[0].send;
+                bestReprRed.push({ name, n, start, end: i + 1 });
+            }
+            return c;
+        });
+        const sup = [sequence, ...indiv_match, bestRepr.join('')];
+        return { short: bestReprRed.flatMap((ee) => ee.name + "{" + ee.n + "}").join("<>"), all_blastn, sup, bestReprRed };
+    }
+    catch (error) {
+        console.log(error);
+        return 1;
+    }
+});
+(() => __awaiter(void 0, void 0, void 0, function* () {
+    const sequence = 'ATCTTCACCACGAACTGCTGCTTGCTCGCTTGCTCCTCAGTCCTAGCTTCATCAAACACTGGTTCCTGGAATCCTGTCTGCTGCTGTCTTCCTAGATTCACTGAATCTTCACCACGAACTGCTGCTTGCTCGCTTGCTCCTCAGTCCTAGCTTCATCAA';
+    const dbs = ['/home/thomas/NGS/ref/RNA/human_rna.fna'];
+    console.log(yield getBlastRepr({ sequence, dbs }));
+}))();

index.ts

@@ -0,0 +1,145 @@
+import { spawn } from 'child_process';
+
+const async_exec = (prog: string, args: string[], onData: Function, onErr: Function) => {
+    return new Promise((resolve, reject) => {
+        const child = spawn(prog, args, {shell: true})
+
+        child.stdout.on('data', data => onData(data.toString().trim()))
+        child.stderr.on('data', data => onErr(data.toString().trim()))
+
+        child.on('error', err => reject(err))
+        child.on('exit', code => resolve(code))
+    })
+}
+
+const diversitySeq = (Seq:string) => {
+    return Seq.split('').reduce((prev, _curr, id, array) => {
+        if (id != 0 && array[id] !== array[id-1])  {
+        return prev + (1/array.length)
+        } else {
+        return prev
+        }
+    }, 0)
+}
+
+const annotateSeq = async (
+    seq: string,
+    blastDB: string, 
+    maxBlast     = 100,
+    minDiversity = 0.1,
+    blastnPath       = 'blastn',
+) => {
+    return new Promise<any>(async (resolve, reject) => {
+        try {
+          let results = ''
+          interface sequence {
+              sequence: string,
+              blastn?: any
+          }
+          let sequence: sequence = {sequence: seq}
+
+          if (sequence.sequence) {
+            if (diversitySeq(sequence.sequence) > minDiversity) {
+              const sequenceStr = '\'>GG\\n' + sequence.sequence + '\''
+  
+              await async_exec('echo', [sequenceStr, '|',
+              blastnPath, '-db', blastDB, '-query', '-', '-outfmt', '6', '-max_target_seqs', '100'], (m:string) => results += m, console.log)
+    
+                  
+              if(results !== '') {
+                //https://www.metagenomics.wiki/tools/blast/blastn-output-format-6
+                const keys = [/*'qseqid',*/ 'sseqid', 'pident', 'length', 'mismatch', 'gapopen', 'qstart', 'qend', 'sstart', 'send', 'evalue', 'bitscore']
+                results.split('\n')
+                    .map((it, index) => sequence.blastn = [
+                            ...(sequence.blastn || []),
+                            {index, ...it.split('\t')
+                                .slice(1)
+                                .reduce((a, v, i) => ({ ...a, [keys[i]]: isNaN(parseInt(v)) ? v : parseInt(v)}), {})}
+                        ].splice(0,maxBlast))
+  
+                if(sequence.blastn.length === 0) {
+                  throw 'Blastn results parsing failed'
+                }
+              } else { 
+                // console.log('WARNING NO BLASTN RESULT', ['echo', '-e', ,'\'' + sequenceStr + '\'', '|',
+                // blastn, '-db', blastDB, '-query', '-', '-outfmt', '6', '-max_target_seqs', '100'].join(' '))
+                throw 'No blastn hit'
+              }
+            } else { throw 'Sequence diversity < ' + minDiversity }
+          } else { throw 'No sequence' }
+          resolve(sequence)
+        } catch (error) {
+            reject(error)
+        }
+    })  
+}
+
+const transpose = (matrix: any) => matrix.reduce(($:any, row:any) => row.map((_:any, i:any) => [...($[i] || []), row[i]]), [])
+const whichMax = (arr:any) => arr.flatMap((v:any, i:any) => v === Math.max(...arr) ? i : [])
+
+const getBlastRepr = async (args: any) => {
+    const {sequence, dbs} = args
+    try {
+        let all_blastn:any = []
+        for (const cdb of dbs) {
+            let res = []
+            try {
+                res = await annotateSeq(sequence, cdb)
+                if (res.blastn.length > 0) all_blastn = [...all_blastn, ...res.blastn].map((v,i) => {return {...v, index: i + 1}})
+            } catch (e) {}
+        }
+
+        const indiv_match = all_blastn.map((blastn:any) => {
+            const {start, end} = blastn.qstart <= blastn.qend ? {start: blastn.qstart, end: blastn.qend} : {end: blastn.qstart, start: blastn.qend}
+            return sequence.split('').map((_:any,i:any) => ((i + 1) >=  start && (i + 1) <= end) ? '|' : '_').join('')
+        })
+
+        const bestRepr = transpose(indiv_match.map((v:any) => v.split(''))).map((v:any) => {
+            const tmp = v.map((c:any,i:any) => {
+                if (c === '|') {
+                    return all_blastn[i].length
+                } else {
+                    return  0
+                }
+            })
+            if (Math.max(...tmp) === 0 ) {
+                return 0
+            } else {
+                return whichMax(tmp)[0] + 1
+            }
+        })
+
+        let bestReprRed: any = []
+        let n = 0
+        let start = 0 
+
+        bestRepr.reduce((p:any,c:any,i:any) => {
+            if (p !== c ) {
+                const name = p === 0 ? 'unknown' : all_blastn.filter((v:any) => v.index === p)[0].sseqid + ":" + all_blastn.filter((v:any) => v.index === p)[0].sstart + '-' + all_blastn.filter((v:any) => v.index === p)[0].send
+                bestReprRed.push({name, n, start, end:i})
+                start = (i+1)
+                n = 0
+            }
+            n++
+            if (i === (bestRepr.length - 1)) {
+                const name = c === 0 ? 'unknown' : all_blastn.filter((v:any) => v.index === c)[0].sseqid  + ":" + all_blastn.filter((v:any) => v.index === c)[0].sstart + '-' + all_blastn.filter((v:any) => v.index === c)[0].send
+                bestReprRed.push({name, n, start, end:i+1})
+            }
+            return c
+        })
+
+        const sup = [sequence, ...indiv_match, bestRepr.join('')]
+
+        return {short: bestReprRed.flatMap((ee:any) => ee.name + "{" + ee.n + "}").join("<>"), all_blastn, sup, bestReprRed}
+    } catch (error) {
+      console.log(error);
+        return 1
+    }
+}
+
+(async()=>{
+    const sequence = 'ATCTTCACCACGAACTGCTGCTTGCTCGCTTGCTCCTCAGTCCTAGCTTCATCAAACACTGGTTCCTGGAATCCTGTCTGCTGCTGTCTTCCTAGATTCACTGAATCTTCACCACGAACTGCTGCTTGCTCGCTTGCTCCTCAGTCCTAGCTTCATCAA'
+    const dbs = ['/home/thomas/NGS/ref/RNA/human_rna.fna']
+    console.log(await getBlastRepr({sequence, dbs}));
+    
+})()

package-lock.json

@@ -0,0 +1,51 @@
+{
+  "name": "blastnrepr",
+  "version": "1.0.0",
+  "lockfileVersion": 2,
+  "requires": true,
+  "packages": {
+    "": {
+      "name": "blastnrepr",
+      "version": "1.0.0",
+      "license": "ISC",
+      "devDependencies": {
+        "@types/node": "^17.0.19",
+        "typescript": "^4.5.5"
+      }
+    },
+    "node_modules/@types/node": {
+      "version": "17.0.19",
+      "resolved": "https://registry.npmjs.org/@types/node/-/node-17.0.19.tgz",
+      "integrity": "sha512-PfeQhvcMR4cPFVuYfBN4ifG7p9c+Dlh3yUZR6k+5yQK7wX3gDgVxBly4/WkBRs9x4dmcy1TVl08SY67wwtEvmA==",
+      "dev": true
+    },
+    "node_modules/typescript": {
+      "version": "4.5.5",
+      "resolved": "https://registry.npmjs.org/typescript/-/typescript-4.5.5.tgz",
+      "integrity": "sha512-TCTIul70LyWe6IJWT8QSYeA54WQe8EjQFU4wY52Fasj5UKx88LNYKCgBEHcOMOrFF1rKGbD8v/xcNWVUq9SymA==",
+      "dev": true,
+      "license": "Apache-2.0",
+      "bin": {
+        "tsc": "bin/tsc",
+        "tsserver": "bin/tsserver"
+      },
+      "engines": {
+        "node": ">=4.2.0"
+      }
+    }
+  },
+  "dependencies": {
+    "@types/node": {
+      "version": "17.0.19",
+      "resolved": "https://registry.npmjs.org/@types/node/-/node-17.0.19.tgz",
+      "integrity": "sha512-PfeQhvcMR4cPFVuYfBN4ifG7p9c+Dlh3yUZR6k+5yQK7wX3gDgVxBly4/WkBRs9x4dmcy1TVl08SY67wwtEvmA==",
+      "dev": true
+    },
+    "typescript": {
+      "version": "4.5.5",
+      "resolved": "https://registry.npmjs.org/typescript/-/typescript-4.5.5.tgz",
+      "integrity": "sha512-TCTIul70LyWe6IJWT8QSYeA54WQe8EjQFU4wY52Fasj5UKx88LNYKCgBEHcOMOrFF1rKGbD8v/xcNWVUq9SymA==",
+      "dev": true
+    }
+  }
+}

package.json

@@ -0,0 +1,18 @@
+{
+  "name": "blastnrepr",
+  "version": "1.0.0",
+  "description": "",
+  "main": "index.js",
+  "scripts": {
+    "prepublish": "npm run build",
+    "build": "tsc",
+    "test": "echo \"Error: no test specified\" && exit 1"
+  },
+  "keywords": [],
+  "author": "",
+  "license": "ISC",
+  "devDependencies": {
+    "@types/node": "^17.0.19",
+    "typescript": "^4.5.5"
+  }
+}

tsconfig.json

@@ -0,0 +1,101 @@
+{
+  "compilerOptions": {
+    /* Visit https://aka.ms/tsconfig.json to read more about this file */
+
+    /* Projects */
+    // "incremental": true,                              /* Enable incremental compilation */
+    // "composite": true,                                /* Enable constraints that allow a TypeScript project to be used with project references. */
+    // "tsBuildInfoFile": "./",                          /* Specify the folder for .tsbuildinfo incremental compilation files. */
+    // "disableSourceOfProjectReferenceRedirect": true,  /* Disable preferring source files instead of declaration files when referencing composite projects */
+    // "disableSolutionSearching": true,                 /* Opt a project out of multi-project reference checking when editing. */
+    // "disableReferencedProjectLoad": true,             /* Reduce the number of projects loaded automatically by TypeScript. */
+
+    /* Language and Environment */
+    "target": "es2016",                                  /* Set the JavaScript language version for emitted JavaScript and include compatible library declarations. */
+    // "lib": [],                                        /* Specify a set of bundled library declaration files that describe the target runtime environment. */
+    // "jsx": "preserve",                                /* Specify what JSX code is generated. */
+    // "experimentalDecorators": true,                   /* Enable experimental support for TC39 stage 2 draft decorators. */
+    // "emitDecoratorMetadata": true,                    /* Emit design-type metadata for decorated declarations in source files. */
+    // "jsxFactory": "",                                 /* Specify the JSX factory function used when targeting React JSX emit, e.g. 'React.createElement' or 'h' */
+    // "jsxFragmentFactory": "",                         /* Specify the JSX Fragment reference used for fragments when targeting React JSX emit e.g. 'React.Fragment' or 'Fragment'. */
+    // "jsxImportSource": "",                            /* Specify module specifier used to import the JSX factory functions when using `jsx: react-jsx*`.` */
+    // "reactNamespace": "",                             /* Specify the object invoked for `createElement`. This only applies when targeting `react` JSX emit. */
+    // "noLib": true,                                    /* Disable including any library files, including the default lib.d.ts. */
+    // "useDefineForClassFields": true,                  /* Emit ECMAScript-standard-compliant class fields. */
+
+    /* Modules */
+    "module": "commonjs",                                /* Specify what module code is generated. */
+    // "rootDir": "./",                                  /* Specify the root folder within your source files. */
+    // "moduleResolution": "node",                       /* Specify how TypeScript looks up a file from a given module specifier. */
+    // "baseUrl": "./",                                  /* Specify the base directory to resolve non-relative module names. */
+    // "paths": {},                                      /* Specify a set of entries that re-map imports to additional lookup locations. */
+    // "rootDirs": [],                                   /* Allow multiple folders to be treated as one when resolving modules. */
+    // "typeRoots": [],                                  /* Specify multiple folders that act like `./node_modules/@types`. */
+    // "types": [],                                      /* Specify type package names to be included without being referenced in a source file. */
+    // "allowUmdGlobalAccess": true,                     /* Allow accessing UMD globals from modules. */
+    // "resolveJsonModule": true,                        /* Enable importing .json files */
+    // "noResolve": true,                                /* Disallow `import`s, `require`s or `<reference>`s from expanding the number of files TypeScript should add to a project. */
+
+    /* JavaScript Support */
+    // "allowJs": true,                                  /* Allow JavaScript files to be a part of your program. Use the `checkJS` option to get errors from these files. */
+    // "checkJs": true,                                  /* Enable error reporting in type-checked JavaScript files. */
+    // "maxNodeModuleJsDepth": 1,                        /* Specify the maximum folder depth used for checking JavaScript files from `node_modules`. Only applicable with `allowJs`. */
+
+    /* Emit */
+    // "declaration": true,                              /* Generate .d.ts files from TypeScript and JavaScript files in your project. */
+    // "declarationMap": true,                           /* Create sourcemaps for d.ts files. */
+    // "emitDeclarationOnly": true,                      /* Only output d.ts files and not JavaScript files. */
+    // "sourceMap": true,                                /* Create source map files for emitted JavaScript files. */
+    // "outFile": "./",                                  /* Specify a file that bundles all outputs into one JavaScript file. If `declaration` is true, also designates a file that bundles all .d.ts output. */
+    // "outDir": "./",                                   /* Specify an output folder for all emitted files. */
+    // "removeComments": true,                           /* Disable emitting comments. */
+    // "noEmit": true,                                   /* Disable emitting files from a compilation. */
+    // "importHelpers": true,                            /* Allow importing helper functions from tslib once per project, instead of including them per-file. */
+    // "importsNotUsedAsValues": "remove",               /* Specify emit/checking behavior for imports that are only used for types */
+    // "downlevelIteration": true,                       /* Emit more compliant, but verbose and less performant JavaScript for iteration. */
+    // "sourceRoot": "",                                 /* Specify the root path for debuggers to find the reference source code. */
+    // "mapRoot": "",                                    /* Specify the location where debugger should locate map files instead of generated locations. */
+    // "inlineSourceMap": true,                          /* Include sourcemap files inside the emitted JavaScript. */
+    // "inlineSources": true,                            /* Include source code in the sourcemaps inside the emitted JavaScript. */
+    // "emitBOM": true,                                  /* Emit a UTF-8 Byte Order Mark (BOM) in the beginning of output files. */
+    // "newLine": "crlf",                                /* Set the newline character for emitting files. */
+    // "stripInternal": true,                            /* Disable emitting declarations that have `@internal` in their JSDoc comments. */
+    // "noEmitHelpers": true,                            /* Disable generating custom helper functions like `__extends` in compiled output. */
+    // "noEmitOnError": true,                            /* Disable emitting files if any type checking errors are reported. */
+    // "preserveConstEnums": true,                       /* Disable erasing `const enum` declarations in generated code. */
+    // "declarationDir": "./",                           /* Specify the output directory for generated declaration files. */
+    // "preserveValueImports": true,                     /* Preserve unused imported values in the JavaScript output that would otherwise be removed. */
+
+    /* Interop Constraints */
+    // "isolatedModules": true,                          /* Ensure that each file can be safely transpiled without relying on other imports. */
+    // "allowSyntheticDefaultImports": true,             /* Allow 'import x from y' when a module doesn't have a default export. */
+    "esModuleInterop": true,                             /* Emit additional JavaScript to ease support for importing CommonJS modules. This enables `allowSyntheticDefaultImports` for type compatibility. */
+    // "preserveSymlinks": true,                         /* Disable resolving symlinks to their realpath. This correlates to the same flag in node. */
+    "forceConsistentCasingInFileNames": true,            /* Ensure that casing is correct in imports. */
+
+    /* Type Checking */
+    "strict": true,                                      /* Enable all strict type-checking options. */
+    // "noImplicitAny": true,                            /* Enable error reporting for expressions and declarations with an implied `any` type.. */
+    // "strictNullChecks": true,                         /* When type checking, take into account `null` and `undefined`. */
+    // "strictFunctionTypes": true,                      /* When assigning functions, check to ensure parameters and the return values are subtype-compatible. */
+    // "strictBindCallApply": true,                      /* Check that the arguments for `bind`, `call`, and `apply` methods match the original function. */
+    // "strictPropertyInitialization": true,             /* Check for class properties that are declared but not set in the constructor. */
+    // "noImplicitThis": true,                           /* Enable error reporting when `this` is given the type `any`. */
+    // "useUnknownInCatchVariables": true,               /* Type catch clause variables as 'unknown' instead of 'any'. */
+    // "alwaysStrict": true,                             /* Ensure 'use strict' is always emitted. */
+    // "noUnusedLocals": true,                           /* Enable error reporting when a local variables aren't read. */
+    // "noUnusedParameters": true,                       /* Raise an error when a function parameter isn't read */
+    // "exactOptionalPropertyTypes": true,               /* Interpret optional property types as written, rather than adding 'undefined'. */
+    // "noImplicitReturns": true,                        /* Enable error reporting for codepaths that do not explicitly return in a function. */
+    // "noFallthroughCasesInSwitch": true,               /* Enable error reporting for fallthrough cases in switch statements. */
+    // "noUncheckedIndexedAccess": true,                 /* Include 'undefined' in index signature results */
+    // "noImplicitOverride": true,                       /* Ensure overriding members in derived classes are marked with an override modifier. */
+    // "noPropertyAccessFromIndexSignature": true,       /* Enforces using indexed accessors for keys declared using an indexed type */
+    // "allowUnusedLabels": true,                        /* Disable error reporting for unused labels. */
+    // "allowUnreachableCode": true,                     /* Disable error reporting for unreachable code. */
+
+    /* Completeness */
+    // "skipDefaultLibCheck": true,                      /* Skip type checking .d.ts files that are included with TypeScript. */
+    "skipLibCheck": true                                 /* Skip type checking all .d.ts files. */
+  }
+}

yarn.lock

@@ -0,0 +1,13 @@
+# THIS IS AN AUTOGENERATED FILE. DO NOT EDIT THIS FILE DIRECTLY.
+# yarn lockfile v1
+
+
+"@types/node@^17.0.19":
+  "integrity" "sha512-PfeQhvcMR4cPFVuYfBN4ifG7p9c+Dlh3yUZR6k+5yQK7wX3gDgVxBly4/WkBRs9x4dmcy1TVl08SY67wwtEvmA=="
+  "resolved" "https://registry.npmjs.org/@types/node/-/node-17.0.19.tgz"
+  "version" "17.0.19"
+
+"typescript@^4.5.5":
+  "integrity" "sha512-TCTIul70LyWe6IJWT8QSYeA54WQe8EjQFU4wY52Fasj5UKx88LNYKCgBEHcOMOrFF1rKGbD8v/xcNWVUq9SymA=="
+  "resolved" "https://registry.npmjs.org/typescript/-/typescript-4.5.5.tgz"
+  "version" "4.5.5"