Thomas 3 years ago
parent
commit
1c824d815a
1 changed files with 26 additions and 11 deletions
  1. 26 11
      src/lib.rs

+ 26 - 11
src/lib.rs

@@ -227,17 +227,18 @@ impl BwaAlign {
 
         if a.len() == 1 {
             let record = a.iter().next().unwrap();
-            let (deletions, insertions) = find_deletion_insertion_ranges(record.pos() as u32 + 1, Cigar::new_from_str(&format!("{}", record.cigar())), record.is_reverse());
-            let contig = self.bwa_tid_contig(record.tid() as usize);
-            deletions.iter().for_each(|(s, e)| {
-                all_ranges.push(("deletion".to_string(), contig.to_string(), *s as i32, *e as i32));
-            });
-            insertions.iter().for_each(|(s, e)| {
-                let s = *s as i32;
-                let e = *e as i32;
-                all_ranges.push(("insertion".to_string(), contig.to_string(), s, e ));
-            });
-            
+            if record.pos() > 0 {
+                let (deletions, insertions) = find_deletion_insertion_ranges(record.pos() as u32 + 1, Cigar::new_from_str(&format!("{}", record.cigar())), record.is_reverse());
+                let contig = self.bwa_tid_contig(record.tid() as usize);
+                deletions.iter().for_each(|(s, e)| {
+                    all_ranges.push(("deletion".to_string(), contig.to_string(), *s as i32, *e as i32));
+                });
+                insertions.iter().for_each(|(s, e)| {
+                    let s = *s as i32;
+                    let e = *e as i32;
+                    all_ranges.push(("insertion".to_string(), contig.to_string(), s, e ));
+                });
+            }
         }
 
         all_ranges
@@ -331,8 +332,11 @@ pub fn format_seq(name: &str, sequence: &str, line_size: usize) -> String {
 }
 
 pub fn find_deletion_insertion_ranges(start_position: u32, cigar: Cigar, is_rc: bool) -> (Vec<(u32, u32)>, Vec<(u32, u32)>) {
+
     let cigar = if is_rc { cigar.expand().chars().rev().collect::<Vec<char>>() } else { cigar.expand().chars().collect::<Vec<char>>() };
 
+    println!("{}", start_position);
+    println!("{:?}", cigar);
     // :-) 
     let mut position = start_position;
     let mut deletion_ranges = Vec::new();
@@ -579,4 +583,15 @@ mod tests {
         println!("{:?}", res);
 
     }
+    #[test]
+    fn deletion_2() {
+        let ref_path = "/home/thomas/NGS/ref/hg19.fa";
+
+        let sequence = "CATCCTGTGGGCAGACAGACAAGCGGATGCC";
+
+        let aligner = BwaAlign::init(ref_path);
+        let res = aligner.get_ref_positions_indel(&sequence);
+        println!("{:?}", res);
+
+    }
 }