| 123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566676869707172737475767778798081828384858687888990919293949596979899100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132133134135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175176177178179180181182183184185186187188189190191192193194195196197198199200201202203204205206207208209210211212213214215216217218219220221222223224225226227228229230231232233234235236237238239240241242243244245246247248249250251252253254255256257258259260261262263264265266267268269270271272273274275276277278279280281282283284285286287288289290291292293294295296297298299300301302303304305306307308309310311312313314315316317318319320321322323324325326327328329330331332333334335336337338339340341342343344345346347348349350351352353354355356357358359360361362363364365366367368369370371372373374375376377378379380381382383384385386387388389390391392393394395396397398399400401402403404405406407408409410411412413414415416417418419420421422423424425426427428429430431432433434435436437438439440441442443444445446447448449450451452453454455456457458459460461462463464465466467468469470471472473474475476477478479480481482483484485486487488489490491492493494495496497498499500501502503504505506507508509510511512513514515516517518519520521522523524525526527528529530531532533534535536537538539540541542543544545546547548549550551552553554555556557558559560561562563564565566567568569570571572573574575576577578579580581582583584585586587588589590591592593594595596597598599600601602603604605606607608609610611612613614615616617618619620621622623624625626627628629630631632633634635636637638639640641642643644645646647648649650651652653654655656657658659660661662663664665666667668669670671672673674675676677678679680681682683684685686687688689690691692693694695696697698699700701702703704705706707708709710711712713714715716717718719720721722723724725726727728729730731732733734735736737738739740741742743744745746747748749750751752753754755756757758759760761762763764765766767768769770771772773774775776777778779780781782783784785786787788789790791792793794795796797798799800801802803804805806807808809810811812813814815816817818819820821822823824825826827828829830831832833834835836837838839840841842843844845846847848849850851852853854855856857858859860861862863864865866867868869870871872873874875876877878879880881882883884885886887888889890891892893894895896897898899900901902903904905906907908909910911912913914915916917918919920921922923924925926927928929930931932933934935936937938939940941942943944945946947948949950951952953954955956957958959960961962963964965966967968969970971972973974975976977978979980981982983984985986987988989990991992993994995996997998999100010011002100310041005100610071008100910101011101210131014101510161017101810191020102110221023102410251026102710281029103010311032103310341035103610371038103910401041104210431044104510461047104810491050105110521053105410551056105710581059106010611062106310641065106610671068106910701071107210731074107510761077107810791080108110821083108410851086108710881089109010911092109310941095109610971098109911001101110211031104110511061107110811091110111111121113111411151116111711181119112011211122112311241125112611271128112911301131113211331134113511361137113811391140114111421143114411451146114711481149115011511152115311541155115611571158115911601161116211631164116511661167116811691170117111721173117411751176117711781179118011811182118311841185118611871188118911901191119211931194119511961197119811991200120112021203120412051206120712081209121012111212121312141215121612171218121912201221122212231224122512261227122812291230123112321233123412351236123712381239124012411242124312441245124612471248124912501251125212531254125512561257125812591260126112621263126412651266126712681269127012711272127312741275127612771278127912801281128212831284128512861287128812891290129112921293129412951296129712981299130013011302130313041305130613071308130913101311131213131314131513161317131813191320132113221323132413251326132713281329133013311332133313341335133613371338133913401341134213431344134513461347134813491350135113521353135413551356135713581359136013611362136313641365136613671368136913701371137213731374137513761377137813791380138113821383138413851386138713881389139013911392139313941395139613971398139914001401140214031404140514061407140814091410141114121413141414151416141714181419142014211422142314241425142614271428142914301431143214331434143514361437143814391440144114421443144414451446144714481449145014511452145314541455145614571458145914601461146214631464146514661467146814691470147114721473147414751476147714781479148014811482148314841485148614871488148914901491149214931494149514961497149814991500150115021503150415051506150715081509151015111512151315141515151615171518151915201521152215231524152515261527152815291530153115321533153415351536153715381539154015411542154315441545154615471548154915501551155215531554155515561557155815591560156115621563156415651566 |
- //! # 🧬 Long-read Somatic Variant Calling and Analysis Framework
- //!
- //! This Rust library provides a modular, parallelizable framework for somatic variant calling, annotation, and interpretation from long-read sequencing data. It is designed to support full pipelines for research and clinical workflows across multiple variant callers and analysis stages.
- //!
- //! The library also serves as an extensible platform that developers can leverage to add custom features, integrate new tools, and tailor workflows to specific use cases.
- //!
- //! ## 🧩 Key Features
- //!
- //! - **POD5 Demultiplexing and Alignment**: End-to-end support for processing ONT POD5 files:
- //! - Barcode-aware demultiplexing using metadata CSVs
- //! - POD5 subsetting and organization by case
- //! - Integration with basecallers (e.g., Dorado) for read alignment
- //! - **Pipeline Management**: Full orchestration of Dockerized execution pipelines for tools such as ClairS, Nanomonsv, DeepVariant, Savana, Modkit, and Severus.
- //! - **Flexible Configuration**: Centralized configuration system (`Config`, `CollectionsConfig`) for all modules and pipelines.
- //! - **Input Abstraction**: Unified handling of BAM, POD5, and VCF file collections across cohorts and directories.
- //! - **Variant Processing**: Modular loading, filtering, statistical analysis, and annotation of somatic and germline variants.
- //! - **Haplotype Phasing and Methylation**: Support for LongPhase-based phasing and Modkit methylation pileups with support for multi-threaded pileup and aggregation.
- //! - **Parallel Execution**: Uses `rayon` for efficient multicore parallelization over large cohorts and tasks.
- //!
- //! ## 📚 Module Highlights
- //!
- //! - `callers`: Interfaces to variant calling tools (ClairS, DeepVariant, Nanomonsv, Savana, etc...)
- //! - `runners`: Pipeline runners (e.g. `Somatic`, `SeverusSolo`, `LongphasePhase`) that manage end-to-end execution.
- //! - `collection`: Organizes input data across BAMs, VCFs, and POD5 files with auto-detection of completed runs.
- //! - `annotation`: VEP line parsing and high-level annotation aggregation.
- //! - `pipes`: Composition modules for executing pipelines across callers and post-processing steps.
- //! - `functions`: Custom logic for genome assembly, entropy estimation, and internal tooling.
- //! - `positions`, `variant`, `helpers`: Utilities for SV modeling, variant filtering, position overlap logic, and helper methods.
- //!
- //! ## ⚡ Workflow Overview
- //!
- //! ### 1. 📦 From POD5 to BAM Alignment
- //!
- //! - **Demultiplexing**: POD5 files are subset and demuxed using barcodes (via CSV metadata).
- //! - **Flowcell Case Management**: Each sample is identified by a [`collection::pod5::FlowCellCase`] containing its ID, time point, and POD5 directory.
- //! - **Alignment**: The [`commands::dorado::Dorado`] module handles alignment of POD5 reads to reference genome, producing BAMs.
- //!
- //! ```rust
- //! let case = FlowCellCase { id: "PATIENT1", time_point: "diag", barcode: "01", pod_dir: "...".into() };
- //! Dorado::init(case, Config::default())?.run_pipe()?;
- //! ```
- //!
- //! ### 2. 🧬 Variant Calling (BAM ➝ VCF)
- //!
- //! Using the aligned BAMs, multiple variant callers can be run in parallel. The [`callers`] and [`runners`] modules support:
- //!
- //! - **ClairS** – somatic small variant calling with LongPhase haplotagging
- //! - **Nanomonsv** – structural variants (SV)
- //! - **DeepVariant** – germline small variants
- //! - **Savana** – SVs and copy number variations (CNV)
- //! - **Modkit** – methylation pileups
- //! - **LongPhase** – phasing and modcalling
- //!
- //! All workflows can be triggered per-case or per-cohort using `Collections` or `Somatic` runners.
- //!
- //! ```rust
- //! ClairS::initialize("PATIENT1", Config::default())?.run()?;
- //! NanomonSV::initialize("PATIENT1", Config::default())?.run()?;
- //! ```
- //!
- //! ### 3. 📈 Aggregation & Statistics (VCF ➝ JSON / Stats)
- //!
- //! After variant calling:
- //!
- //! - Annotate with VEP ([`annotation`] module)
- //! - Load and filter with [`variant::variant_collection`]
- //! - Compute variant and region-level stats (e.g., mutation rates, alteration categories, coding overlaps)
- //!
- //! ```rust
- //! let variants = Variants::load_from_json("/path/to/somatic_variants.json.gz")?;
- //! let stats = VariantsStats::new(&variants, "PATIENT1", &config)?;
- //! stats.save_to_json("/output/path/stats.json.gz")?;
- //! ```
- //!
- //! ### 4. 🧠 Intelligent Task Management (`collection` module)
- //!
- //! - Auto-discovers available samples, POD5s, BAMs, and VCFs
- //! - Detects missing outputs and creates task lists
- //! - Tasks are parallelizable using Rayon and can be run on-demand
- //!
- //! ```rust
- //! let mut collections = Collections::new(CollectionsConfig::default())?;
- //! collections.todo()?; // Identify missing steps
- //! collections.run()?; // Run them automatically
- //! ```
- //!
- //! ## 🔬 Testing
- //!
- //! Integration tests demonstrate the entire pipeline. Run with logging enabled:
- //!
- //! ```bash
- //! export RUST_LOG=debug
- //! cargo test -- --nocapture
- //! ```
- //!
- //! ## 🧪 Example Use Cases
- //!
- //! - Full somatic variant calling pipeline on matched tumor/normal samples
- //! - POD5-based pipeline from raw signal to variants
- //! - Aggregation and annotation of SVs across a clinical cohort
- //! - Methylation analysis using nanopore-specific tools
- //! - Variant calling and analysis in large-scale longitudinal studies
- //!
- //! ## 🚀 Getting Started
- //!
- //! All workflows are initialized from `Config` and driven by the `Collections` structure:
- //!
- //! ```rust
- //! let collections = Collections::new(CollectionsConfig::default())?;
- //! collections.todo()?;
- //! collections.run()?;
- //! ```
- //!
- //! ## 🔗 References
- //!
- //! **Basecalling and alignment**
- //! - Dorado: <https://github.com/nanoporetech/dorado>
- //!
- //! **Variants Callers**
- //! - ClairS: <https://github.com/HKU-BAL/ClairS>
- //! - Nanomonsv: <https://github.com/friend1ws/nanomonsv>
- //! - Savana: <https://github.com/cortes-ciriano-lab/savana>
- //! - DeepVariant: <https://github.com/google/deepvariant>
- //! - DeepSomatic: <https://github.com/google/deepsomatic>
- //! - LongPhase: <https://github.com/PorubskyResearch/LongPhase>
- //! - Modkit: <https://github.com/nanoporetech/modkit>
- //!
- //! **Variants annotation**
- //! - VEP: <https://www.ensembl.org/info/docs/tools/vep/index.html>
- //!
- //! ---
- use std::sync::{Arc, Mutex};
- pub mod commands;
- pub mod config;
- pub mod modkit;
- pub mod callers;
- pub mod runners;
- pub mod collection;
- pub mod functions;
- pub mod helpers;
- pub mod variant;
- pub mod io;
- pub mod pipes;
- pub mod positions;
- pub mod annotation;
- pub mod cases;
- pub mod scan;
- pub mod math;
- #[macro_use]
- extern crate lazy_static;
- // Define DOCKER_ID lock for handling Docker kill when ctrlc is pressed
- lazy_static! {
- static ref DOCKER_ID: Arc<Mutex<Vec<String>>> = Arc::new(Mutex::new(Vec::new()));
- }
- #[cfg(test)]
- mod tests {
- use std::{collections::HashMap, fs, path::Path};
- use annotation::{vep::{VepLine, VEP}, Annotations};
- use callers::{nanomonsv::nanomonsv_create_pon, savana::{Savana, SavanaReadCounts}, severus::{Severus, SeverusSolo}};
- use collection::{bam::{counts_at, counts_ins_at, nt_pileup, WGSBam, WGSBamStats}, Initialize, InitializeSolo, Version};
- use commands::{longphase::{LongphaseConfig, LongphaseHap, LongphaseModcallSolo, LongphasePhase}, modkit::{bed_methyl, ModkitConfig}};
- use functions::assembler::{Assembler, AssemblerConfig};
- use helpers::estimate_shannon_entropy;
- use io::bed::read_bed;
- use itertools::Itertools;
- use log::{debug, error, info, warn};
- use pandora_lib_variants::variants::VariantCategory;
- use pipes::somatic::SomaticPipe;
- use positions::{overlaps_par, GenomePosition, GenomeRange};
- use rayon::prelude::*;
- use runners::Run;
- use variant::{variant::{Variants, VcfVariant}, variant_collection};
- use self::{collection::pod5::{FlowCellCase, Pod5Collection}, commands::dorado, config::Config};
- use super::*;
- use crate::{annotation::Annotation, callers::{clairs::ClairS, deep_variant::DeepVariant, nanomonsv::{NanomonSV, NanomonSVSolo}, savana::SavanaCN}, collection::{bam::{self, nt_pileup_new}, flowcells::{scan_archive, FlowCells}, run_tasks, vcf::VcfCollection, Collections, CollectionsConfig, ShouldRun}, commands::dorado::Dorado, helpers::find_files, io::{bed::bedrow_overlaps_par, dict::read_dict, gff::features_ranges}, pipes::somatic::const_stats, positions::{merge_overlapping_genome_ranges, range_intersection_par, sort_ranges}, scan::scan::somatic_scan, variant::{variant::{AlterationCategory, BNDDesc, BNDGraph, GroupByThreshold, ToBNDGraph}, variant_collection::{group_variants_by_bnd_desc, group_variants_by_bnd_rc, Variant, VariantCollection}, variants_stats::{self, somatic_depth_quality_ranges, VariantsStats}}};
- // export RUST_LOG="debug"
- fn init() {
- let _ = env_logger::Builder::from_env(env_logger::Env::default().default_filter_or("info"))
- .is_test(true)
- .try_init();
- }
- #[test]
- fn it_works() {
- let bam_path = "/data/longreads_basic_pipe/PARACHINI/diag/PARACHINI_diag_hs1.bam";
- modkit::modkit(bam_path);
- }
- #[test]
- fn run_dorado() -> anyhow::Result<()> {
- let case = FlowCellCase {
- id: "CONSIGNY".to_string(),
- time_point: "mrd".to_string(), barcode: "07".to_string(), pod_dir: "/data/run_data/20240326-CL/CONSIGNY-MRD-NB07_RICCO-DIAG-NB08/20240326_1355_1E_PAU78333_bc25da25/pod5_pass/barcode07".into()
- };
- dorado::Dorado::init(case, Config::default())?.run_pipe()
- }
- #[test]
- fn pod5() -> anyhow::Result<()> {
- let _ = env_logger::Builder::from_env(env_logger::Env::default().default_filter_or("info"))
- .build();
- let coll = Pod5Collection::new(
- "/data/run_data",
- "/data/flow_cells.tsv",
- "/data/longreads_basic_pipe",
- )?;
- println!("{coll:#?}");
- // let runs = Runs::import_dir("/home/prom/store/banana-pool/run_data", "/data/flow_cells.tsv")?;
- Ok(())
- }
- #[test]
- fn bam() -> anyhow::Result<()> {
- init();
- let bam_collection = bam::load_bam_collection("/data/longreads_basic_pipe");
- bam_collection
- .bams
- .iter()
- // .filter(|b| matches!(b.bam_type, BamType::Panel(_)))
- .for_each(|b| println!("{b:#?}"));
- let u = bam_collection.get("PARACHINI", "mrd");
- println!("{u:#?}");
- Ok(())
- }
- #[test]
- fn vcf() -> anyhow::Result<()> {
- init();
- let mut vcf_collection = VcfCollection::new("/data/longreads_basic_pipe");
- vcf_collection.sort_by_id();
- vcf_collection
- .vcfs
- .iter()
- .for_each(|v| v.println().unwrap());
- Ok(())
- }
- // pod5 view -I /data/run_data/20240903-CL/ARMEM-DG-N02_ASSJU-DG-N03/20240903_1428_1B_PAW47629_fc24c3cf/pod5/PAW47629_fc24c3cf_77b07847_0.pod5 | head -5000 | awk '{if(NR==1){print "target,"$0}else{print "subset_1.pod5,"$0}}' > /tmp/subset_ids.csv
- // pod5 subset /data/run_data/20240903-CL/ARMEM-DG-N02_ASSJU-DG-N03/20240903_1428_1B_PAW47629_fc24c3cf/pod5/PAW47629_fc24c3cf_77b07847_0.pod5 --csv /tmp/subset_ids.csv -o /data/test_suite/pod5/muxed/
- #[test]
- fn mux() -> anyhow::Result<()> {
- init();
- let result_dir = "/data/test_suite/results".to_string();
- let cases = vec![
- FlowCellCase { id: "test_02".to_string(), time_point: "diag".to_string(), barcode: "02".to_string(), pod_dir: "/data/test_suite/pod5/muxed".into() },
- FlowCellCase { id: "test_03".to_string(), time_point: "diag".to_string(), barcode: "03".to_string(), pod_dir: "/data/test_suite/pod5/muxed".into() },
- ];
- cases.iter().for_each(|c| {
- let dir = format!("{result_dir}/{}", c.id);
- if Path::new(&dir).exists() {
- fs::remove_dir_all(dir).unwrap();
- }
- });
- let config = Config { result_dir, ..Default::default() };
- Dorado::from_mux(cases, config)
- }
- // #[test_log::test]
- // fn clairs() -> anyhow::Result<()> {
- // let config = ClairSConfig {
- // result_dir: "/data/test".to_string(),
- // ..ClairSConfig::default()
- // };
- // ClairS::new("test_a", "/data/test_data/subset.bam", "/data/test_data/subset_mrd.bam", config).run()
- // }
- #[test]
- fn nanomonsv() -> anyhow::Result<()> {
- init();
- let id = "HAMROUNE";
- NanomonSV::initialize(id, Config::default())?.run()
- }
- #[test]
- fn nanomddonsv_solo() -> anyhow::Result<()> {
- init();
- NanomonSVSolo::initialize("BRETON", "diag", Config::default())?.run()
- }
- // cargo test run -- --nocapture; ~/run_scripts/notify_finish.sh &
- #[test]
- fn todo_all() -> anyhow::Result<()> {
- init();
- // let config = CollectionsConfig::default();
- let config = CollectionsConfig { pod_dir: "/data/run_data".to_string(), ..Default::default() };
- info!("Runing todo with config: {:#?}", config);
- let mut collections = Collections::new(config)?;
- collections.todo()?;
- collections.tasks.iter().for_each(|t| println!("{t}"));
- println!("{}", collections.tasks.len());
- Ok(())
- }
- // #[test]
- // fn todo_agg() -> anyhow::Result<()> {
- // init();
- // let config = CollectionsConfig::default();
- // info!("Runing todo with config: {:#?}", config);
- // let collections = Collections::new(config)?;
- // let agg_tasks = collections.todo_variants_agg()?;
- // println!("{:#?}", agg_tasks);
- // println!("{}", agg_tasks.len());
- // Ok(())
- // }
- // #[test]
- // fn run_agg() -> anyhow::Result<()> {
- // init();
- // let config = CollectionsConfig {
- // id_black_list: vec!["MANCUSO".to_string(),"HAMROUNE".to_string()],
- // ..Default::default()
- // };
- // info!("Runing todo with config: {:#?}", config);
- // let mut collections = Collections::new(config)?;
- // collections.tasks = collections.todo_variants_agg()?;
- // collections.run()?;
- //
- // Ok(())
- // }
- // export RUST_LOG="debug"
- #[test]
- fn run_t() -> anyhow::Result<()> {
- init();
- // let config = CollectionsConfig::default();
- let config = CollectionsConfig { pod_dir: "/data/run_data".to_string(), ..Default::default() };
- run_tasks(config)
- }
- // #[test_log::test]
- // fn bcftools_pass() {
- // let config = BcftoolsConfig::default();
- // let id = "RICCO";
- // let time = "diag";
- // let caller = "DeepVariant";
- //
- // Config::default();
- //
- // // let (i, o) =
- // // let i = format!("/data/longreads_basic_pipe/{id}/{time}/nanomonsv/{id}_diag.nanomonsv.result.vcf");
- // // let o = format!("/data/longreads_basic_pipe/{id}/{time}/nanomonsv/{id}_diag_nanomonsv_PASSED.vcf.gz");
- // bcftools_keep_pass(&i, &o, config).unwrap();
- // }
- #[test]
- fn bam_ok() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- let mut res: Vec<_> = collections.bam.by_id_completed(15.0, 10.0).iter().map(|b| {
- (b.id.to_string(), b.time_point.to_string(), b.path.to_str().unwrap().to_string())
- }).collect();
- res.sort_by_key(|b| b.1.clone());
- res.sort_by_key(|b| b.0.clone());
-
- res.iter().for_each(|(id, tp, path)| println!("{id}\t{tp}\t{path}"));
- Ok(())
- }
- #[test]
- fn todo_assembler() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- collections.todo_assembler()?;
- Ok(())
- }
- #[test]
- fn sv_pon() -> anyhow::Result<()> {
- init();
- nanomonsv_create_pon(&Config::default(), "/data/ref/hs1/nanomonsv_pon.vcf.gz")
- }
- #[test]
- fn todo_mod() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- collections.todo_mod_pileup();
- Ok(())
- }
- #[test]
- fn todo_deepv() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- let tasks = collections.todo_deepvariants();
- tasks.iter().for_each(|t| info!("{t}"));
- info!("n tasks {}", tasks.len());
- Ok(())
- }
- #[test]
- fn todo_clairs() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- collections.todo_clairs().iter().for_each(|t| info!("{t}"));
- Ok(())
- }
- #[test]
- fn run_assemblers() -> anyhow::Result<()> {
- Assembler::new("CAMEL".to_string(), "diag".to_string(), AssemblerConfig::default()).run()
- }
- // #[test]
- // fn run_dmr_par() -> anyhow::Result<()> {
- // init();
- // let collections = Collections::new(
- // CollectionsConfig::default()
- // )?;
- // let tasks = collections.todo_dmr_c_diag_mrd();
- // tasks.iter().for_each(|t| info!("{t}"));
- // let len = tasks.len();
- // // let pool = ThreadPoolBuilder::new().num_threads(10).build().unwrap();
- // // pool.install(|| {
- // // tasks.par_iter().enumerate().for_each(|(i, t)| {
- // // let config = ModkitConfig {threads: 2, ..Default::default() };
- // // if let collection::CollectionsTasks::DMRCDiagMrd { id, .. } = t { let _ = dmr_c_mrd_diag(id, &config); }
- // // println!("⚡ {i}/{len}");
- // // });
- // // });
- // Ok(())
- // }
- #[test]
- fn run_mod_par() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- let tasks = collections.todo_mod_pileup();
- let len = tasks.len();
- tasks.par_iter().enumerate().for_each(|(i, t)| {
- let config = ModkitConfig {threads: 2, ..Default::default() };
- if let collection::CollectionsTasks::ModPileup { bam, .. } = t { let _ = bed_methyl(bam.to_owned(), &config); }
- println!("⚡ {i}/{len}");
- });
- Ok(())
- }
- #[test]
- fn run_severus() -> anyhow::Result<()> {
- init();
- Severus::initialize("CAMEL", Config::default())?.run()
- }
- #[test]
- fn run_severus_solo() -> anyhow::Result<()> {
- init();
- SeverusSolo::initialize("CAMEL","diag", Config::default())?.run()
- }
- #[test]
- fn run_savana() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- for bam in collections.bam.by_id_completed(15.0, 10.0).iter() {
- let id = &bam.id;
- match ClairS::initialize(id, Config::default())?.run() {
- Ok(_) => match Savana::initialize(id, Config::default())?.run() {
- Ok(_) => (),
- Err(e) => error!("{e}"),
- },
- Err(e) => error!("{e}"),
- }
- ;
- }
- Ok(())
- }
- #[test]
- fn check_versions() -> anyhow::Result<()> {
- init();
- let config = Config::default();
- let v = Savana::version(&config)?;
- info!("Savanna version {v}");
- let v = Severus::version(&config)?;
- info!("Severus version {v}");
- Ok(())
- }
- #[test]
- fn run_multi_deepvariant() -> anyhow::Result<()> {
- init();
- let mut collections = Collections::new(
- CollectionsConfig::default()
- )?;
- collections.run_deepvariant()
- }
- #[test]
- fn run_deepvariant() -> anyhow::Result<()> {
- init();
- DeepVariant::initialize("HAMROUNE", "diag", Config::default())?.run()
- }
- #[test]
- fn run_clairs() -> anyhow::Result<()> {
- init();
- ClairS::initialize("ADJAGBA", Config::default())?.run()
- }
- #[test]
- fn run_longphase() -> anyhow::Result<()> {
- init();
- let id = "BECERRA";
- let diag_bam = format!("/data/longreads_basic_pipe/{id}/diag/{id}_diag_hs1.bam");
- let vcf = format!("/data/longreads_basic_pipe/{id}/diag/ClairS/clair3_normal_tumoral_germline_output.vcf.gz");
- let mrd_bam = format!("/data/longreads_basic_pipe/{id}/mrd/{id}_mrd_hs1.bam");
- LongphaseHap::new(id, &diag_bam, &vcf, LongphaseConfig::default()).run()?;
- LongphaseHap::new(id, &mrd_bam, &vcf, LongphaseConfig::default()).run()
- }
- #[test]
- fn run_longphase_modcall() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let time = "diag";
- LongphaseModcallSolo::initialize(id, time, Config::default())?.run()
- }
- #[test]
- fn run_longphase_phase() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- LongphasePhase::initialize(id, Config::default())?.run()
- }
- #[test]
- fn snv_parse() -> anyhow::Result<()> {
- init();
- // ClairS
- let row = "chr1\t10407\t.\tA\tG\t10.1\tPASS\tF\tGT:GQ:DP:AD:AF\t0/1:10:31:10,20:0.6452";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let mut variant_col = VariantCollection {
- variants: vec![variant],
- vcf: collection::vcf::Vcf::new("/data/longreads_basic_pipe/ACHITE/diag/ClairS/ACHITE_diag_clairs_PASSED.vcf.gz".into())?,
- caller: Annotation::Callers(annotation::Caller::ClairS, annotation::Sample::Somatic)
- };
- let annotations = Annotations::default();
- variant_col.annotate_with_constit_bam(&annotations, "/data/longreads_basic_pipe/ACHITE/mrd/ACHITE_mrd_hs1.bam", 1)?;
- // DeepVariant
- let row = "chr1\t10407\t.\tA\tG\t7.4\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t1/1:5:9:1,8:0.888889:5,5,0";
- variant_col.variants.push(row.parse()?);
- let anns: Vec<Vec<Annotation>> = variant_col.variants.iter()
- .filter_map(|e| {
- annotations.store.get(&e.hash()).map(|v| v.value().to_owned())
- })
- .collect();
- assert_eq!(anns[0], anns[1]);
- Ok(())
- }
- #[test]
- fn deletion_parse() -> anyhow::Result<()> {
- init();
- // Clairs
- let row = "chr1\t16760\t.\tAaag\tA\t8.48\tPASS\tF\tGT:GQ:DP:AD:AF\t0/1:8:39:22,17:0.4359";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- // case are not keeped
- assert_eq!(&var_string, "chr1\t16760\t.\tAAAG\tA\t8.48\tPASS\tF\tGT:GQ:DP:AD:AF\t0/1:8:39:22,17:0.4359");
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- let mut variant_col = VariantCollection {
- variants: vec![variant],
- vcf: collection::vcf::Vcf::new("/data/longreads_basic_pipe/ACHITE/diag/ClairS/ACHITE_diag_clairs_PASSED.vcf.gz".into())?,
- caller: Annotation::Callers(annotation::Caller::ClairS, annotation::Sample::Somatic)
- };
- let annotations = Annotations::default();
- // DeepVariant, VAF is not an f32 at it should be, sometimes too long removed the last number for eq
- let row = "chr12\t326911\t.\tGTGTA\tG\t4.7\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t0/1:5:8:5,3:0.37500:2,0,21";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- variant_col.variants.push(row.parse()?);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- // Severus, 0000 added to VAF and hVAF
- let row = "chr10\t108974982\tseverus_DEL885\tN\t<DEL>\t60\tPASS\tPRECISE;SVTYPE=DEL;SVLEN=474;END=108975456;STRANDS=+-;INSIDE_VNTR=TRUE;MAPQ=60\tGT:GQ:VAF:hVAF:DR:DV\t0/1:61:0.30000:0.30000,0.00000,0.00000:7:3";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- // Nanomonsv dont parse last format remove: \t22:0 and nt putted in uppercase
- let row = "chr14\t5247080\td_106\tG\t<DEL>\t.\tPASS\tEND=5247255;SVTYPE=DEL;SVLEN=-175;SVINSLEN=39;SVINSSEQ=ATAACCCAGGTGATATAACACTTCTTTAGGCTCTGCCTA\tTR:VR\t18:3";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- let row = "chr1\t20654667\t.\tTG\tT\t3.5\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t0/1:3:23:20,3:0.13044:0,0,16";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- let row = "chr1\t2160094\t.\tTCTGACAGCCTGGAACAGCACCCACAACCGCAGGTGAGCATCTGACAGCCCGCAGCAGCACCCACACGCACAGGTGAGAATCTGACAGCCCGGAGCAGCACCCACACAGGCAGGGGAGCATCTGACATCCTGGAGCAGCACCGACAACCCCAGGTGAGCAACTGAGAGCCTGGAACAGCACCCACACCCCCAGGTGAGAATCTGACAGCCTGGAAGAGCACCCCACATCCCCGGGTGAGCATCTGACAGCCTGGAACAGCATCAACACCCCCAGGTGAGCATCCGATAGCCTGGAGCAGCACCCACACCCTCAGGTGAGCATCTGACAGCCTGGAACAGCAACCACACCCCCAGGTGAACATCTGACAGCCCGGAGCAGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGGAACAGCACCCACACCCCCAGGAGAGCATCCGGTAGCCTGGAGCAGAACCCACACCCACAGGCGAGCATCTGACAGCCTGGGTTGGCACCCACACCCCCAGGTGAGCATCTGATGGTCTGGAGCAGCACCCACACCTACAGGAGAGCATCTGACAACCTGCAACAGAACCCAAACCCCCAGGTGAGCATCTGACAGACTGGAACAGCACCCTGCACCCCCAGGTGAGTATCTGACGGCCTGGAACAGAACACACAAGCCCAGGTGAGCATCCGACAGCCTGGAGCAGCACCCACACCCCCAGGTGAGCATCAGACAGCCTGGAGTAGCACCCCACACCCCCAGGTGAGCATCCGACAGCCTGGAGCAGCACCCACACTCACCAGGTGAGCATGTGACATGCTGGAACAGCACCCACACCCCCAGGCGAGCATCTGACAGCCTGGAGCGGCACCCCACACCCCCAGGTGAGCATCGGACAGCCTGGAGCAGTACCCACACCCCCAGGTGAGCATCCGACAGCCTGGAACAGCACCCACACCCCCAGGTGAGCATCTGACAGACAGGAACAGCACCCACATGTCCAGGTGAGCCTCTGACAGACTGGAACAGCACGCGCACCCCCAGGTGAGCATCTGACAGGCTGGAACAGCACCCACACCCCCAGGAGAGCATCTTACAGCATGTAACAGCACCCACACACCCACGTGAGCATCTGACAGCCTGGAACAGCACCCTGCACCCCCAGGTGCGCACGTGACAGCCTGGAACAGCACCCACACCCCCAGGCGAGCATCGGACAGCCTGGAGCAGCACCCCACACCCGCAGGTGAGCATCCGACAGCCTGGAGCAGCACCCACACCCCCAGGTGAGCATGTGACAGCCTGGAACAGCACCCACACCCCCAGGCGAGCATCTGACAGCCTGGAGCAACACCCCACACCCCCAGGTGAGCATCGAACTGTCTGGAGCAGCACCCACAACCACAGGTGGGCATCGGAGAGAGTGGAGCAGCGCCCAGACCACCAGGCAAGCATCTGACAGCCTGGAGCAGTGCCCACACCCCCATGTGAGCATCTGACAGTATGGAGCAGCACCCACAGCCCAAGGTGAGCATCTGACAACCTGGAGCAGCACCCACACCCCCAGGCGAGCATCTGAACGCACAGAGCAGCACCCACACCCCCAGGCGAGCATCCGACAGCGTGGAGCAGCACCCACACTCCCAGGTGCGCGTGTGATGGTCTGGGGCAGCACCCACACACACAGGTGAGCCTGCGACAGCCTGGAGCAGCACCCACAGCCCCAGGTGAGCATCTGATGGTCTGGAGCAGCACCCACAACCACAGGTGAGCATCGGAGAGACTGGAGCAGCGCCGAAACCCCCAGGCGAACATTTGAGAGCCTGGAGCAGTGCCGACACCCCCAGGTGAGCATCTGACACCGTGGAGCAGCACCCACAGCCCAAGGTGAGCATCTGACAACCTGGAGCAGCACCCACAGCCCCAGGCGAGCATTTGAACGCACGGAGCAGGACCTACAGCCCCAGGCGAGCATCCGACAGCCTGGAGCAGCACCCACACACCCAGGTGAGCATCTGACAGCCTGGAGCAGCACCCACAACCCCAGGGGAGCATCTGACCGCATGGAATGGCATCCTCACCCGTAGGTGAACGTCCGACAGCCTGGAGCAGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGGAACAGCACCTGCACCCCCGGGTGAGGATCAGATAGCCTGGAGCAGCACCCACACTCCAGGTGAGCATCTGACAGCCTGAAGCAGCACCCACACCAACAGGTGAGCATCTGACAGCCTGGAAGAGCACCCACAACCCCACGTGAGCATCTGACAGCCTGGAACAGGACCCTGCACCCCAAAGTGAGCATCTGACAACCTGGAGCAGGAACCACAACCCCAGGTGAGCATCTGATAGCCTGGAATAGCACCCACACACCCAGGTGAGCATCTGAGAGCCTGGAGCAGCACCCACACCCCCAGGTGAGCATCCGACAGCCTGGAACAGTACCCACACACCCAGGCGAGCATCTGACAGCCTGAAACAGCACACACACTCCCAGGTGAGCATCTCATATGCTGGAACAGCACCCACACCCCCAGGTGAGCATCTGACTGCCCGGAGCAGCACGCACACCCCCGGGTGAGCATCTGATAGCCTGGAACAGCACCCACACCCCCAGATGAGCATCCGACAGCCTGGAGCGGAGCCCACAGCCCCAGGCGAGCATCTGACAGCCTGGAACAGCACCCTGCATCCCCGGGTGAGGATCAGACAGCCTGGAGCAGCACCCACACTCCAGGTGAGCATCTGACAGCCTGAAGCAGCACCCACACCAACAGGTGAGCCTCTGACAGCCTGCAACAGCACCCACACCCCAAGGTGAGCATCTGACAGCCTGGAAGAGGACCCTGCAGCCCCAAGTGAGCATCTGACAACCTGAAGCAGCAACCACACTCCAAGGTGAGCATCCAACAGCCTGGAACAGCACCCACACACCCAGGTGAGCATCTGACAGCCTGGAGCAGCACCACACCCCCAGGTGAGCATCCGACAGCCTGGAACAGCACCTACAAACCCAGGAGAGCATCCGACAGCCTGGAGCAGCACCCACACCCCCAGGCGAGCATCTGACAGCCCGGAGCAGCACGCAAACCCCCAGGTGAGCATCTGATACCCTGGAACAGCACCCACACACCCAGGTGAGCATCCGACAGCCTAGAGCTGAACCCACACCAACAGGAGAGCATCTGACAGCCTGGGTCGGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGGAACAGCACCCTGCACCCTCAGGTGCGCACGTGACAGCCTGGAACAGCACCCACACACCCAGGCGAGCATCTGACGGCCTGGAACGGCACCCACACCCCGAGGCGAGCATGGGACAGCCTGGAGAGCAGCCACACCCTCAGATGAGCATCTGACAGCCTGGAACAGCACCCTGCACCCCCAGGTGAGCATCTGACAGCCTGGAACAGGACCCACGTCCCCAGGCGAGCAA\tT\t3.1\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t0/1:3:15:11,4:0.26667:0,0,22";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- let row = "chr1\t27073397\t.\tTGGGG\tT\t28.9\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t./.:2:13:1,3:0.23077:24,2,26";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- let row = "chrY\t639648\t.\tCTTTTTT\tC\t10.4\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t0/1:1:7:0,2:0.28571:4,0,2";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- let row = "chr11\t31260259\tseverus_BND1077_1\tN\t]chr11:36214171]N\t60\tPASS\tPRECISE;SVTYPE=BND;SVLEN=4953912;MATE_ID=severus_BND1077_2;STRANDS=+-;MAPQ=60\tGT:GQ:VAF:hVAF:DR:DV\t0/1:68:0.67000:0.67000,0.00000,0.00000:4:8";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::DEL, variant.alteration_category());
- println!("{:#?}", variant.deletion_desc());
- variant_col.variants.push(row.parse()?);
- variant_col.annotate_with_constit_bam(
- &annotations,
- "/data/longreads_basic_pipe/ACHITE/mrd/ACHITE_mrd_hs1.bam",
- 1
- )?;
- Ok(())
- }
- #[test]
- fn insertion_parse() -> anyhow::Result<()> {
- init();
- // Clairs
- let row = "chr1\t23005\t.\tT\tTCAC\t3.1\tPASS\tF\tGT:GQ:DP:AD:A\t0/1:3:13:9,4:0.3077";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(&var_string, row);
- assert_eq!(AlterationCategory::INS, variant.alteration_category());
- let mut variant_col = VariantCollection {
- variants: vec![variant],
- vcf: collection::vcf::Vcf::new("/data/longreads_basic_pipe/ACHITE/diag/ClairS/ACHITE_diag_clairs_PASSED.vcf.gz".into())?,
- caller: Annotation::Callers(annotation::Caller::ClairS, annotation::Sample::Somatic)
- };
- let annotations = Annotations::default();
- // DeepVariant, VAF is not an f32 at it should be, sometimes too long removed the last number for eq
- let row = "chrX\t152732993\t.\tG\tGTTTTTTTTT\t18.9\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t1/1:3:6:0,5:0.50000:15,7,3";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- variant_col.variants.push(row.parse()?);
- assert_eq!(AlterationCategory::INS, variant.alteration_category());
- // Severus, 0000 added to VAF and hVAF
- let row = "chr11\t26669932\tseverus_INS9403\tN\tT\t60\tPASS\tPRECISE;SVTYPE=INS;SVLEN=460;INSIDE_VNTR=TRUE;MAPQ=60\tGT:GQ:VAF:hVAF:DR:DV\t0/1:71:0.27000:0.27000,0.00000,0.00000:8:3";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::INS, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
- // Nanomonsv dont parse last format remove: \t22:0 and nt putted in uppercase
- let row = "chr8\t87940084\td_333\tT\t<INS>\t.\tPASS\tEND=87940201;SVTYPE=INS;SVINSLEN=172;SVINSSEQ=TA\tTR:VR\t9:5";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- assert_eq!(AlterationCategory::INS, variant.alteration_category());
- variant_col.variants.push(row.parse()?);
-
- variant_col.annotate_with_constit_bam(
- &annotations,
- "/data/longreads_basic_pipe/ACHITE/mrd/ACHITE_mrd_hs1.bam",
- 1
- )?;
- Ok(())
- }
- #[test]
- fn trl_parse() -> anyhow::Result<()> {
- init();
- let row = "chr2\t207968575\tID_16420_1\ta\ta]chr11:41497080]\t.\tPASS\tSVTYPE=BND;MATEID=ID_16420_2;TUMOUR_READ_SUPPORT=4;TUMOUR_ALN_SUPPORT=4;NORMAL_READ_SUPPORT=0;NORMAL_ALN_SUPPORT=0;SVLEN=0;BP_NOTATION=++;SOURCE=SUPPLEMENTARY;CLUSTERED_READS_TUMOUR=4;CLUSTERED_READS_NORMAL=0;ORIGIN_STARTS_STD_DEV=0.433;ORIGIN_MAPQ_MEAN=56.25;ORIGIN_EVENT_SIZE_STD_DEV=0;ORIGIN_EVENT_SIZE_MEDIAN=0;ORIGIN_EVENT_SIZE_MEAN=0;END_STARTS_STD_DEV=17.754;END_MAPQ_MEAN=56.25;END_EVENT_SIZE_STD_DEV=0;END_EVENT_SIZE_MEDIAN=0;END_EVENT_SIZE_MEAN=0;TUMOUR_DP_BEFORE=8,11;TUMOUR_DP_AT=4,11;TUMOUR_DP_AFTER=4,11;NORMAL_DP_BEFORE=7,16;NORMAL_DP_AT=7,16;NORMAL_DP_AFTER=7,16;TUMOUR_AF=1,0.364;NORMAL_AF=0,0;TUMOUR_TOTAL_HP_AT=1,3,0;NORMAL_TOTAL_HP_AT=4,3,0;TUMOUR_ALT_HP=2,1,1;TUMOUR_PS=207946665;NORMAL_ALT_HP=0,0,0;CLASS=PREDICTED_SOMATIC\tGT\t0/1";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- let u = variant.n_alt_depth();
- println!("{u:?}");
- Ok(())
- }
- #[test]
- fn variant_parse() -> anyhow::Result<()> {
- let row = "chr1\t1366\t.\tC\tCCCT\t8.2\tPASS\t.\tGT:GQ:DP:AD:VAF:PL\t1/1:4:6:1,4:0.66667:6,4,0";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let row = "chr1\t1366\t.\tC\tCCCT\t8.2\tPASS\t.";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let row = "chr1\t2628434\t.\tC\tT\t17.973\tPASS\tH;FAU=0;FCU=7;FGU=0;FTU=7;RAU=0;RCU=2;RGU=0;RTU=2\tGT:GQ:DP:AF:AD:NAF:NDP:NAD:AU:CU:GU:TU:NAU:NCU:NGU:NTU\t0/1:17:18:0.5:0,9:0:11:0,0:0:9:0:9:0:11:0:0";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let row = "chr1\t52232\t.\tC\tCT\t18\t.\t.\tGT:GQ:DP:AD:AF\t1/.:1:24:3,5:0.208333";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let row = "chr1\t52232\t.\tC\tCT\t18\t.\t.\tGT:GQ:DP:AD:AF\t1/1:1:24:3,5:0.208333";
- let variant_b: VcfVariant = row.parse()?;
- assert_eq!(variant, variant_b);
- let row = "chr1\t475157\t.\tA\tG\t12.301\tPASS\tH;FAU=2;FCU=0;FGU=2;FTU=0;RAU=3;RCU=0;RGU=3;RTU=0\tGT:GQ:DP:AF:AD:NAF:NDP:NAD:AU:CU:GU:TU:NAU:NCU:NGU:NTU\t0/1:12:10:0.5:0,5:0.0769:13:0,1:5:0:5:0:12:0:1:0";
- let variant: VcfVariant = row.parse()?;
- let var_string = variant.into_vcf_row();
- assert_eq!(row, &var_string);
- let row = "chr1\t161417408\tr_10_0\tT\t[chr1:161417447[TTGGCAGGTTCC\t.\tPASS\tSVTYPE=BND;MATEID=r_10_1;SVINSLEN=11;SVINSSEQ=TTGGCAGGTTC\tTR:VR\t22:3\t12:0";
- let variant: VcfVariant = row.parse()?;
- println!("{variant:#?}");
- let u = variant.bnd_desc();
- println!("{u:#?}");
- // Severus mates are not in RC
- let vcf = "chr7\t27304522\tseverus_BND6747_1\tN\t[chr6:32688062[N\t60\tPASS\tPRECISE;SVTYPE=BND;MATE_ID=severus_BND6747_2;STRANDS=--;MAPQ=60;CLUSTERID=severus_2\tGT:VAF:hVAF:DR:DV\t0/1:0.29:0.29,0,0:12:5";
- let variant: VcfVariant = vcf.parse()?;
- let bnd_a = variant.bnd_desc()?;
- let vcf = "chr6\t32688062\tseverus_BND6747_2\tN\t[chr7:27304522[N\t60\tPASS\tPRECISE;SVTYPE=BND;MATE_ID=severus_BND6747_1;STRANDS=--;MAPQ=60;CLUSTERID=severus_2 GT:VAF:hVAF:DR:DV\t0/1:0.29:0.29,0,0:12:5";
- let variant: VcfVariant = vcf.parse()?;
- let bnd_b = variant.bnd_desc()?;
- assert_eq!(bnd_a, bnd_b.rc());
- println!("{bnd_a}\n{bnd_b}");
- // Savana here each mate are in RC
- let vcf = "chr10\t102039096\tID_35957_2\tG\t]chr10:101973386]G\t.\tPASS\tSVTYPE=BND;MATEID=ID_35957_1;TUMOUR_READ_SUPPORT=7;TUMOUR_ALN_SUPPORT=7;NORMAL_READ_SUPPORT=0;NORMAL_ALN_SUPPORT=0;SVLEN=65710;BP_NOTATION=+-;SOURCE=SUPPLEMENTARY;CLUSTERED_READS_TUMOUR=7;CLUSTERED_READS_NORMAL=0;ORIGIN_STARTS_STD_DEV=0.35;ORIGIN_MAPQ_MEAN=60;ORIGIN_EVENT_SIZE_STD_DEV=7.248;ORIGIN_EVENT_SIZE_MEDIAN=65710;ORIGIN_EVENT_SIZE_MEAN=65705.4;END_STARTS_STD_DEV=7.007;END_MAPQ_MEAN=60;END_EVENT_SIZE_STD_DEV=7.248;END_EVENT_SIZE_MEDIAN=65710;END_EVENT_SIZE_MEAN=65705.4;TUMOUR_DP_BEFORE=38,29;TUMOUR_DP_AT=44,21;TUMOUR_DP_AFTER=44,21;NORMAL_DP_BEFORE=13,15;NORMAL_DP_AT=13,15;NORMAL_DP_AFTER=13,15;TUMOUR_AF=0.159,0.333;NORMAL_AF=0,0;TUMOUR_TOTAL_HP_AT=20,16,8;NORMAL_TOTAL_HP_AT=6,7,0;TUMOUR_ALT_HP=0,1,6;TUMOUR_PS=101917152;NORMAL_ALT_HP=0,0,0;CLASS=PREDICTED_SOMATIC\tGT\t0/1";
- let variant: VcfVariant = vcf.parse()?;
- let bnd_a = variant.bnd_desc()?;
- let vcf = "chr10\t101973386\tID_35957_1\tA\tA[chr10:102039096[\t.\tPASS\tSVTYPE=BND;MATEID=ID_35957_2;TUMOUR_READ_SUPPORT=7;TUMOUR_ALN_SUPPORT=7;NORMAL_READ_SUPPORT=0;NORMAL_ALN_SUPPORT=0;SVLEN=65710;BP_NOTATION=+-;SOURCE=SUPPLEMENTARY;CLUSTERED_READS_TUMOUR=7;CLUSTERED_READS_NORMAL=0;ORIGIN_STARTS_STD_DEV=0.35;ORIGIN_MAPQ_MEAN=60;ORIGIN_EVENT_SIZE_STD_DEV=7.248;ORIGIN_EVENT_SIZE_MEDIAN=65710;ORIGIN_EVENT_SIZE_MEAN=65705.4;END_STARTS_STD_DEV=7.007;END_MAPQ_MEAN=60;END_EVENT_SIZE_STD_DEV=7.248;END_EVENT_SIZE_MEDIAN=65710;END_EVENT_SIZE_MEAN=65705.4;TUMOUR_DP_BEFORE=29,38;TUMOUR_DP_AT=21,44;TUMOUR_DP_AFTER=21,44;NORMAL_DP_BEFORE=15,13;NORMAL_DP_AT=15,13;NORMAL_DP_AFTER=15,13;TUMOUR_AF=0.333,0.159;NORMAL_AF=0,0;TUMOUR_TOTAL_HP_AT=17,0,4;NORMAL_TOTAL_HP_AT=5,7,3;TUMOUR_ALT_HP=0,6,1;TUMOUR_PS=101917152;NORMAL_ALT_HP=0,0,0;CLASS=PREDICTED_SOMATIC\tGT\t0/1";
- let variant: VcfVariant = vcf.parse()?;
- let bnd_b = variant.bnd_desc()?;
- assert_eq!(bnd_a, bnd_b);
- println!("{bnd_a}\n{bnd_b}");
- // Deletions
- // Severus
- let vcf = "chr7\t143674704\tseverus_DEL7318\tN\t<DEL>\t60\tPASS≥\tPRECISE;SVTYPE=DEL;SVLEN=3642;END=143678346;STRANDS=+-;MAPQ=60\tGT:GQ:VAF:hVAF:DR:DV\t0/1:114:0.39:0.39,0,0:14:9";
- let variant: VcfVariant = vcf.parse()?;
- println!("{:?}", variant.infos);
- println!("{:?}", variant.formats);
- let del = variant.deletion_desc().unwrap();
- println!("{:?}", del);
- println!("{:?} {:?}", del.len(), variant.formats.n_alt_depth());
- assert_eq!("chr7:143674704_143678346_del", variant.deletion_desc().unwrap().to_string());
- println!("--\n");
- let vcf="chr7\t144003249\tr_106\tC\t<DEL>\t.\tPASS\tEND=144142733;SVTYPE=DEL;SVLEN=-139484;SVINSLEN=4;SVINSSEQ=GCCA\tTR:VR\t12:10\t51:0";
- let variant: VcfVariant = vcf.parse()?;
- println!("{:?}", variant.infos);
- println!("{:?}", variant.formats);
- let del = variant.deletion_desc().unwrap();
- println!("{:?}", del);
- println!("{:?} {:?}", del.len(), variant.formats.n_alt_depth());
- let path = "/data/ref/hs1/chm13v2.0_RefSeq_Liftoff_v5.1_Genes.bed";
- let r = read_bed(path)?;
-
- let deleted_genes = bedrow_overlaps_par(&r, &vec![&GenomeRange { contig: variant.position.contig, range: del.start..del.end }]).into_iter().filter_map(|e| {
- e.name
- }).collect::<Vec<String>>().join(", ");
- println!("{deleted_genes}");
- Ok(())
- }
- #[test]
- fn variant_load_deepvariant() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let time = "diag";
- let dv = DeepVariant::initialize(id, time, Config::default())?;
- let annotations = Annotations::default();
- let variant_collection = dv.variants(&annotations)?;
- println!("Deepvariant for {id} {time}: variants {} {}", variant_collection.variants.len(), variant_collection.vcf.n_variants);
- Ok(())
- }
- #[test]
- fn variant_load_clairs() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let clairs = ClairS::initialize(id, Config::default())?;
- let annotations = Annotations::default();
- let variant_collection = clairs.variants(&annotations)?;
- println!("ClairS for {id}: variants {} {}", variant_collection.variants.len(), variant_collection.vcf.n_variants);
- Ok(())
- }
- #[test]
- fn variant_load_nanomonsv() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let nanomonsv = NanomonSV::initialize(id, Config::default())?;
- let annotations = Annotations::default();
- let variant_collection = nanomonsv.variants(&annotations)?;
- println!("NanomonSV for {id}: variants {} {}", variant_collection.variants.len(), variant_collection.vcf.n_variants);
- println!("{:?}", variant_collection.variants.first());
- Ok(())
- }
- #[test]
- fn variant_load_clairs_germline() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let clairs = ClairS::initialize(id, Config::default())?;
- let annotations = Annotations::default();
- let germline_variant_collection = clairs.germline(&annotations)?;
- println!("ClairS for {id}: variants {} {}", germline_variant_collection.variants.len(), germline_variant_collection.vcf.n_variants);
- Ok(())
- }
- #[test]
- fn pipe_somatic() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- let c = Config {
- somatic_pipe_force: true,
- ..Default::default()
- };
- for (a, _) in collections.bam_pairs().iter() {
- if ["AUBERT", "BAFFREAU", "BAILLEUL"].contains(&a.id.as_str()) {
- continue;
- }
- if let Err(e) = SomaticPipe::initialize(&a.id, c.clone()).map(|mut p| if p.should_run() {
- if let Err(e) = p.run() {
- error!("{e}");
- }
- }) {
- error!("{e}");
- }
- }
- Ok(())
- // let id = "VILI";
- // SomaticPipe::initialize(id, Config::default())?.run()
- }
- #[test]
- fn overlaps() {
- init();
- let positions = vec![
- &GenomePosition { contig: 1, position: 100 },
- &GenomePosition { contig: 1, position: 150 },
- &GenomePosition { contig: 1, position: 200 },
- &GenomePosition { contig: 2, position: 150 },
- ];
- let ranges = vec![
- &GenomeRange { contig: 1, range: 50..150 },
- &GenomeRange { contig: 2, range: 100..200 },
- ];
- let parallel_overlapping_indices = overlaps_par(&positions, &ranges);
- assert_eq!(parallel_overlapping_indices, vec![0, 3])
- }
- #[test]
- fn bed_read() -> anyhow::Result<()> {
- init();
- let path = &Config::default().mask_bed("ADJAGBA");
- let r = read_bed(path)?;
- println!("{}", r.len());
- Ok(())
- }
- #[test]
- fn test_read_dict() -> anyhow::Result<()> {
- init();
- let genome = read_dict(&Config::default().dict_file)?;
- let genome_length: usize = genome.into_iter().map(|(_, len)| len as usize).sum();
- println!("{genome_length}");
- Ok(())
- }
- #[test]
- fn bases_at() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let c = Config::default();
- let chr = "chr3";
- let position = 62416039; // 1-based
- let mut bam = rust_htslib::bam::IndexedReader::from_path(c.solo_bam(id, "diag"))?;
- let p = nt_pileup(&mut bam, chr, position - 1, false)?.iter().map(|e| String::from_utf8(vec![*e]).unwrap()).collect::<Vec<_>>();
- let mut counts = HashMap::new();
- for item in p.iter() {
- *counts.entry(item.as_str()).or_insert(0) += 1;
- }
- for (key, value) in &counts {
- println!("{}: {}", key, value);
- }
- assert_eq!(8, *counts.get("C").unwrap());
- assert_eq!(13, *counts.get("G").unwrap());
- assert_eq!(6, *counts.get("D").unwrap());
- let chr = "chr1";
- let position = 3220; // 1-based
- let mut bam = rust_htslib::bam::IndexedReader::from_path(c.solo_bam(id, "mrd"))?;
- let p = counts_at(&mut bam, chr, position - 1)?;
- println!("{p:#?}");
- Ok(())
- }
- #[test]
- fn seq_at() -> anyhow::Result<()> {
- init();
- let c = Config::default();
- let chr = "chr1";
- let position = 16761;
- let mut fasta_reader = noodles_fasta::indexed_reader::Builder::default().build_from_path(c.reference)?;
- let r = io::fasta::sequence_at(&mut fasta_reader, chr, position, 3)?;
- println!("{r} ({} {:.2})", r.len(), estimate_shannon_entropy(r.as_str()));
- Ok(())
- }
- #[test]
- fn ins_at() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let c = Config::default();
- let chr = "chr1";
- let position = 52232; // 1-based like in vcf
- let mut bam = rust_htslib::bam::IndexedReader::from_path(c.solo_bam(id, "mrd"))?;
- // let p = ins_pileup(&mut bam, chr, position - 1, true)?.iter().map(|e| String::from_utf8(vec![*e]).unwrap()).collect::<Vec<_>>();
- let counts = counts_ins_at(&mut bam, chr, position -1)?;
- for (key, value) in &counts {
- println!("{}: {}", key, value);
- }
-
- Ok(())
- }
- #[test]
- fn vep_line() -> anyhow::Result<()> {
- init();
- let line = "chr2_1922358_-/T\tchr2:1922357-1922358\tT\tMYT1L\tNM_001303052.2\tTranscript\tintron_variant\t-\t-\t-\t-\t-\t-\tIMPACT=MODIFIER;STRAND=-1;SYMBOL=MYT1L;SOURCE=chm13v2.0_RefSeq_Liftoff_v5.1_sorted.gff3.gz;HGVSc=NM_001303052.2:c.1619-613dup";
- let vep_line: VepLine = line.parse()?;
- println!("{vep_line:#?}");
- let vep: VEP = VEP::try_from(&vep_line)?;
- println!("{vep:#?}");
- Ok(())
- }
- #[test]
- fn savana_cn() -> anyhow::Result<()> {
- init();
- let id = "CAMARA";
- // let s = SavanaCopyNumber::load_id(id, Config::default())?;
- let s = SavanaReadCounts::load_id(id, Config::default())?;
- println!("tumoral reads: {}", s.n_tumoral_reads());
- println!("normal reads: {}", s.n_normal_reads());
- println!("tumoral:\n{:#?}", s.norm_chr_counts());
- Ok(())
- }
- #[test]
- fn coverage() -> anyhow::Result<()> {
- init();
- let id = "CAMARA";
- let time = "diag";
- WGSBamStats::new(id, time, Config::default())?.print();
- Ok(())
- }
- #[test]
- fn load_bam() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let time = "diag";
- let bam_path = Config::default().solo_bam(id, time);
- WGSBam::new(Path::new(&bam_path).to_path_buf())?;
- Ok(())
- }
- #[test]
- fn tar() -> anyhow::Result<()> {
- init();
- scan_archive("/data/lto/20241030_CUNVI-DG-N20_SEBZA-DG-N21.tar")?;
- Ok(())
- }
- #[test]
- fn run_somatic() -> anyhow::Result<()> {
- init();
- let collections = Collections::new(
- CollectionsConfig::default()
- )?;
- let bams = collections.bam.by_id_completed(15.0, 10.0);
- let n = bams.len();
- let mut config = Config::default();
- // config.somatic_scan_force = true;
- warn!("{n} cases");
- for (i, bam) in bams.iter().enumerate() {
- let id = &bam.id;
- warn!("{i}/{n} {id}");
- if id == "BANGA" {
- continue;
- }
- if id == "ARM" {
- continue;
- }
- match SomaticPipe::initialize(id, config.clone())?.run() {
- Ok(_) => (),
- Err(e) => error!("{id} {e}"),
- };
- }
- Ok(())
- }
- #[test]
- fn somatic_cases() -> anyhow::Result<()> {
- init();
- let id = "ACHITE";
- let config = Config { somatic_pipe_force: true, ..Default::default() };
- match SomaticPipe::initialize(id, config)?.run() {
- Ok(_) => (),
- Err(e) => error!("{id} {e}"),
- };
- Ok(())
- }
-
- #[test]
- fn load_variants() -> anyhow::Result<()> {
- init();
- let id = "ACHITE";
- let config = Config::default();
- let path = format!("{}/{id}/diag/{id}_somatic_variants.bit", config.result_dir);
- let variants = variant_collection::Variants::load_from_file(&path)?;
- println!("n variants {}", variants.data.len());
- let n_vep: usize = variants.data.iter().map(|v| v.vep().len()).sum();
- println!("VEP: {n_vep}");
- let translocations = variants.get_alteration_cat(AlterationCategory::TRL);
- println!("{} translocations", translocations.len());
- let threshold = 5;
- let res = group_variants_by_bnd_desc(&translocations, 5);
-
- let rres = group_variants_by_bnd_rc(&res, threshold);
- rres.iter().for_each(|group| {
- println!("{} {}", group.0.len(), group.1.len());
- });
-
- Ok(())
- }
- #[test]
- fn load_fc() -> anyhow::Result<()> {
- init();
- // FlowCells::load_archive_from_scan("/data/lto", "/data/archives.json")?;
- let r = FlowCells::load("/home/prom/mnt/store",
- "/data/pandora_id_inputs.json", "/data/archives.json.gz")?;
- println!("{r:#?}");
- Ok(())
- }
- #[test]
- fn alt_cat() -> anyhow::Result<()> {
- let id = "ADJAGBA";
- let config = Config::default();
- let path = format!("{}/{id}/diag/somatic_variants.json.gz", config.result_dir);
- let variants = variant_collection::Variants::load_from_json(&path)?;
- println!("n variants {}", variants.data.len());
- variants.data.iter()
- .filter(|v| v.alteration_category().contains(&AlterationCategory::TRL))
- .for_each(|v| {
- println!("{:?} {}",
- v.vcf_variants.iter().map(|v| v.bnd_desc()).collect::<Vec<_>>(),
- v.annotations.iter().filter(|a| matches!(a, Annotation::Callers(..))).map(|a| a.to_string()).collect::<Vec<String>>().join(";")
- )
- });
- Ok(())
- }
- #[test]
- fn variants_stats() -> anyhow::Result<()> {
- init();
- let config = Config::default();
- let all_variants_bit = find_files(&format!("{}/*/diag/*_somatic_variants.bit", config.result_dir))?;
- for v in all_variants_bit.into_iter() {
- let id = v.file_name().unwrap().to_str().unwrap().split("_somatic").next().unwrap();
- println!("{id}");
- let config = Config::default();
- let path = format!("{}/{id}/diag/{id}_somatic_variants.bit", config.result_dir);
- match variant_collection::Variants::load_from_file(&path) {
- Ok(mut variants) => {
- let (mut high_depth_ranges, _) =
- somatic_depth_quality_ranges(&id, &config)?;
- high_depth_ranges.par_sort_by_key(|r| (r.contig, r.range.start));
- let res = VariantsStats::new(&mut variants, id, &config, &high_depth_ranges)?.save_to_json(&format!(
- "{}/{id}/diag/{id}_somatic_variants_stats.json.gz", config.result_dir));
- if res.is_err() {
- info!("{:#?}", res);
- }
- },
- Err(e) => error!("{e}"),
- }
- }
- Ok(())
- }
- #[test]
- fn constit_stats() {
- init();
- let id = "ADJAGBA";
- let config = Config::default();
- let _ = const_stats(id.to_string(), config);
- }
- #[test]
- fn test_bnd() -> anyhow::Result<()> {
- init();
- let id = "COIFFET";
- let config = Config::default();
- let annotations = Annotations::default();
- let s = Savana::initialize(id, config)?.variants(&annotations)?;
- s.variants.iter().for_each(|e| {
- if let Ok(bnd) = e.bnd_desc() {
- println!("{}\t{}\t{}", e.position , e.reference, e.alternative);
- println!("{:#?}", bnd);
- }
- });
- Ok(())
- }
- #[test]
- fn parse_savana_seg() {
- init();
- let r = SavanaCN::parse_file("ADJAGBA", &config::Config::default()).unwrap().segments;
- println!("{} lines", r.len());
- println!("{:#?}", r.first().unwrap());
- }
- #[test]
- fn whole_scan() -> anyhow::Result<()> {
- init();
- let id = "CHENU";
- let mut config = Config::default();
- let u = config.solo_bam(id, "mrd");
- println!("{u}");
- config.somatic_scan_force = true;
- somatic_scan(id, &config)?;
- Ok(())
- }
- #[test]
- fn parse_gff() -> anyhow::Result<()> {
- init();
- let id = "ADJAGBA";
- let config = Config::default();
- let path = format!("{}/{id}/diag/somatic_variants.bit", config.result_dir);
- let exon_ranges = features_ranges("exon", &config)?;
- let exon_ranges = merge_overlapping_genome_ranges(&exon_ranges);
-
- let variants = variant_collection::Variants::load_from_file(&path)?;
- let full = variants_stats::somatic_rates(&variants.data, &exon_ranges, &config);
- info!("{full:#?}");
- // let restrained: Vec<variant_collection::Variant> = variants.data.iter().filter(|v| v.vcf_variants.len() >= 2)
- // .cloned().collect();
- // let min_2 = variants_stats::somatic_rates(&restrained, &exon_ranges, &config);
- // info!("{min_2:#?}");
- //
- // let restrained: Vec<variant_collection::Variant> = restrained.iter().filter(|v| v.vcf_variants.len() >= 3)
- // .cloned().collect();
- // let min_3 = variants_stats::somatic_rates(&restrained, &exon_ranges, &config);
- // info!("{min_3:#?}");
- // let mut high_depth_ranges = variants_stats::high_depth_somatic(id, &config)?;
- // high_depth_ranges.par_sort_by_key(|r| ( r.contig, r.range.start ));
- //
- // let exon_ranges_ref: Vec<&GenomeRange> = exon_ranges.iter().collect();
- // let exons_high_depth = range_intersection_par(&high_depth_ranges.iter().collect::<Vec<&GenomeRange>>(), &exon_ranges_ref);
- //
- // let full = variants_stats::somatic_rates(&variants.data, &exons_high_depth, &config);
- // info!("{full:#?}");
- //
- // info!("n variants loaded: {}", variants.data.len());
- //
- // let r = features_ranges("exon", &config::Config::default())?;
- // info!("n exon: {}", r.len());
- //
- // let merged = merge_overlapping_genome_ranges(&r);
- // info!("n merged exon: {}", merged.len());
- //
- // let ol = par_overlaps(&variants.data, &r);
- // info!("variants in exon {}", ol.len());
- //
- // let n_coding = ol.iter().filter_map(|i| variants.data[*i].best_vep().ok() ).filter_map(|bv| bv.impact()).filter(|impact| *impact <= VepImpact::MODERATE).count();
- // info!("coding variants {n_coding}");
- //
- // let n_bases_m = merged.par_iter().map(|gr| gr.length()).sum::<u32>();
- // info!("{n_bases_m}nt");
- //
- // let mega_base_m = n_bases_m as f64 / 10.0e6;
- //
- // let wgs_len = read_dict(&config.dict_file)?.iter().map(|(_, l)| *l).sum::<u32>();
- // info!("wgs len {wgs_len}");
- // let rate_wgs = variants.data.len() as f64 / (wgs_len as f64 / 10.0e6);
- // info!("somatic mutation rate {rate_wgs:.2}/mb");
- //
- // let n_exons_mb = ol.len() as f64 / mega_base_m;
- // info!("somatic mutation rate in the coding region {n_exons_mb:.2}/mb");
- //
- // let n_exons_mb = n_coding as f64 / mega_base_m;
- // info!("somatic non synonymous mutation rate in the coding region {n_exons_mb:.2}/mb");
- Ok(())
- }
- fn gr(contig: u8, start: u32, end: u32) -> GenomeRange {
- GenomeRange {
- contig,
- range: start..end,
- }
- }
- #[test]
- fn test_both_empty() {
- let a: Vec<&GenomeRange> = vec![];
- let b: Vec<&GenomeRange> = vec![];
- let result = range_intersection_par(&a, &b);
- assert!(result.is_empty());
- }
- #[test]
- fn test_one_empty() {
- let a = [gr(1, 0, 100)];
- let b: Vec<&GenomeRange> = vec![];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b);
- sort_ranges(&mut result);
- assert!(result.is_empty());
- }
- #[test]
- fn test_single_range_no_overlap() {
- let a = [gr(1, 0, 100)];
- let b = [gr(1, 100, 200)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- sort_ranges(&mut result);
- assert!(result.is_empty());
- }
- #[test]
- fn test_single_range_full_overlap() {
- let a = [gr(1, 0, 100)];
- let b = [gr(1, 0, 100)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 0, 100)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn test_different_contigs() {
- let a = [gr(1, 0, 100)];
- let b = [gr(2, 0, 100)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- sort_ranges(&mut result);
- assert!(result.is_empty());
- }
- #[test]
- fn test_touching_ranges() {
- let a = [gr(1, 0, 100)];
- let b = [gr(1, 100, 200)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- sort_ranges(&mut result);
- assert!(result.is_empty());
- }
- #[test]
- fn test_complete_subrange() {
- let a = [gr(1, 0, 200)];
- let b = [gr(1, 50, 150)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 50, 150)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn test_multiple_overlaps_same_contig() {
- let a = [gr(1, 0, 50), gr(1, 75, 125)];
- let b = [gr(1, 25, 100), gr(1, 150, 200)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 25, 50), gr(1, 75, 100)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn test_multiple_contigs() {
- let a = [gr(1, 0, 100), gr(2, 50, 150), gr(3, 200, 300)];
- let b = [gr(1, 50, 150), gr(2, 0, 100), gr(4, 0, 100)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 50, 100), gr(2, 50, 100)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn test_adjacent_ranges() {
- let a = [gr(1, 0, 50), gr(1, 50, 100)];
- let b = [gr(1, 25, 75)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 25, 50), gr(1, 50, 75)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn test_minimal_overlap() {
- let a = [gr(1, 0, 100)];
- let b = [gr(1, 99, 200)];
- let a_refs: Vec<&GenomeRange> = a.iter().collect();
- let b_refs: Vec<&GenomeRange> = b.iter().collect();
- let mut result = range_intersection_par(&a_refs, &b_refs);
- let mut expected = [gr(1, 99, 100)];
- sort_ranges(&mut result);
- sort_ranges(&mut expected);
- assert_eq!(result, expected);
- }
- #[test]
- fn todo_scan() -> anyhow::Result<()> {
- init();
- let mut collections = Collections::new(
- CollectionsConfig::default()
- )?;
- collections.todo_bam_count(&Config::default())?;
- collections.tasks.iter().for_each(|t| info!("{t}"));
- let pool = rayon::ThreadPoolBuilder::new()
- .num_threads(100)
- .build()
- .unwrap();
- pool.install(move || {
- collections.tasks.into_iter().for_each(|t| {
- // info!("{t}");
- if let Err(e) = t.run() {
- error!("{e}");
- }
- });
- });
- Ok(())
- }
- /// helper to build a forward‑strand BND (same contig) where
- /// A = pos, B = pos + 5
- fn fwd(contig: &str, pos: u32) -> BNDDesc {
- BNDDesc {
- a_contig: contig.into(),
- a_position: pos,
- a_sens: true,
- b_contig: contig.into(),
- b_position: pos + 5,
- b_sens: true,
- added_nt: String::new(),
- }
- }
- /// Build a six‑node *forward* chain relying **only** on `auto_connect()`
- /// (no manual edges) and assert the Hamiltonian path spans all nodes.
- #[test]
- fn hamiltonian_chain_auto() {
- // positions 10,15 20,25 … 60,65 satisfy B(u) ≤ A(v)
- let bnds: Vec<BNDDesc> = (1..=6).map(|i| fwd("chr1", i * 10)).collect();
- let g: BNDGraph<()> = bnds.to_bnd_graph(); // trait uses auto_connect()
- // ensure auto_connect produced 5 edges in a line
- assert_eq!(g.inner().edge_count(), 5);
- let path = g.hamiltonian_path().expect("chain should be Hamiltonian");
- assert_eq!(path.len(), 6);
- }
- /// Two disconnected "V" shapes -> auto_connect creates 2 edges in each
- /// component, no Hamiltonian path, components sorted by size.
- #[test]
- fn components_after_auto_connect() {
- // comp1: a->b<-c on reverse strand of chrX
- let a = BNDDesc {
- a_contig: "chrX".into(), a_position: 300, a_sens: false,
- b_contig: "chrX".into(), b_position: 250, b_sens: false,
- added_nt: String::new()
- };
- let b = BNDDesc {
- a_contig: "chrX".into(), a_position: 200, a_sens: false,
- b_contig: "chrX".into(), b_position: 150, b_sens: false,
- added_nt: String::new()
- };
- let c = BNDDesc {
- a_contig: "chrX".into(), a_position: 100, a_sens: false,
- b_contig: "chrX".into(), b_position: 50, b_sens: false,
- added_nt: String::new()
- };
- // comp2: three‑node forward chain on chrY
- let d = fwd("chrY", 10);
- let e = fwd("chrY", 20);
- let f = fwd("chrY", 30);
- let g: BNDGraph<()> = vec![a,b,c,d,e,f].to_bnd_graph();
- assert!(g.hamiltonian_path().is_none());
- let comps = g.components_by_size();
- comps.iter().for_each(|a| println!("{}", g.fmt_path(a) ));
- assert_eq!(comps.len(), 2);
- assert_eq!(comps[0].len(), 3);
- assert_eq!(comps[1].len(), 3);
- }
- #[test]
- fn bnd_connections() {
- // comp1: a->b<-c on reverse strand of chrX
- let a = BNDDesc {
- a_contig: "chrX".into(), a_position: 300, a_sens: true,
- b_contig: "chr14".into(), b_position: 250, b_sens: false,
- added_nt: String::new()
- };
- let b = BNDDesc {
- a_contig: "chr14".into(), a_position: 200, a_sens: false,
- b_contig: "chrX".into(), b_position: 301, b_sens: true,
- added_nt: String::new()
- };
- let c = BNDDesc {
- a_contig: "chrX".into(), a_position: 302, a_sens: true,
- b_contig: "chrZ".into(), b_position: 50, b_sens: false,
- added_nt: String::new()
- };
- // comp2: three‑node forward chain on chrY
- let d = fwd("chrY", 10);
- let e = fwd("chrY", 20);
- let f = fwd("chrY", 30);
- let g: BNDGraph<()> = vec![a,b,c,d,e,f].to_bnd_graph();
- assert!(g.hamiltonian_path().is_none());
- let comps = g.components_by_size();
- comps.iter().for_each(|a| println!("{}", g.fmt_path(a) ));
- assert_eq!(comps.len(), 2);
- assert_eq!(comps[0].len(), 3);
- assert_eq!(comps[1].len(), 3);
- }
- }
|